znf532

Ensembl ID:
ENSDARG00000052894
ZFIN ID:
ZDB-GENE-060531-40
Description:
Novel zinc finger protein [Source:UniProtKB/TrEMBL;Acc:A8E7H6]
Human Orthologue:
ZNF532
Human Description:
zinc finger protein 532 [Source:HGNC Symbol;Acc:30940]
Mouse Orthologue:
Zfp532
Mouse Description:
zinc finger protein 532 Gene [Source:MGI Symbol;Acc:MGI:3036282]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37244 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084035 Nonsense 487 1294 1 8
ENSDART00000139495   None 69 None 5
ENSDART00000143257   None 123 None 3
ENSDART00000144460   None 76 None 2
ENSDART00000146248 Nonsense 487 1294 3 10
Genomic Location (Zv9):
Chromosome 21 (position 9331691)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 10703744
GRCz11 21 10796372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCAGAGTGCCAGCAGTGCCATCCTTAAAGCTGCTAATGCCATTCAG[C/T]AACAAACTGTCATGGTGCCTGCTTCCAGTCTAACAAACACCAAACTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link