zgc:111868

Ensembl ID:
ENSDARG00000052879
ZFIN ID:
ZDB-GENE-050809-138
Description:
hypothetical protein LOC556628 [Source:RefSeq peptide;Acc:NP_001030142]
Human Orthologue:
RGAG1
Human Description:
retrotransposon gag domain containing 1 [Source:HGNC Symbol;Acc:29245]
Mouse Orthologue:
Rgag1
Mouse Description:
retrotransposon gag domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2685231]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15734 Nonsense Available for shipment Available now
sa22169 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074812   None 400 None 3
ENSDART00000124492 Nonsense 397 840 4 4
Genomic Location (Zv9):
Chromosome 12 (position 44353470)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 42210319
GRCz11 12 42365608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGCCATCCCAAGTGAATCTCAGTCTCCRTTGCAGCCTTCCWCTAGCT[T/A]GTYATCTGGTTTTCAGTCTTCCAGTACTGGGTCTCAGAGTGTCACATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074812 Nonsense 288 400 2 3
ENSDART00000124492 Nonsense 589 840 4 4
Genomic Location (Zv9):
Chromosome 12 (position 44354047)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 42209742
GRCz11 12 42365031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTACCTCTGGTGTATATACCCCAACTGCTGTTAAAGAAGTTCTCATGTA[C/A]AGTCAGGCTGCCCCAAGTGAATCTTTGTCCATACTGCAGCCTTCCACTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link