NP_571093.1
- Ensembl ID:
- ENSDARG00000052866
- Description:
- huntingtin [Source:RefSeq peptide;Acc:NP_571093]
- Human Orthologue:
- HTT
- Human Description:
- huntingtin [Source:HGNC Symbol;Acc:4851]
- Mouse Orthologue:
- Htt
- Mouse Description:
- huntingtin Gene [Source:MGI Symbol;Acc:MGI:96067]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa15014 |
Essential Splice Site |
Available for shipment |
Available now |
sa39659 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa19545 |
Nonsense |
Available for shipment |
Available now |
sa39658 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa38282 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa45079 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa19544 |
Nonsense |
Available for shipment |
Available now |
sa39657 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa12352 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa15014
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Essential Splice Site |
385 |
3121 |
11 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41740855)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40657096 |
GRCz11 |
1 |
41359883 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGKAGAAAMATGGTGTTGTAACAATATGCMTTGTATGTTATGCTTTTATT[A/T]GGCAAACTGTTGTCAGGTGAAGAAGARGGTTTGGARGAWGATCCTGAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39659
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Nonsense |
472 |
3121 |
12 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41736149)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40652390 |
GRCz11 |
1 |
41355177 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGTGCATCAGAGCAGGGAGTCGGGCCTGATACTCCAGATGAGGAAGAC[G/T]AGGAAGACATGCTAAGCCGTAGCTCAAGCGGAGGCGCCGGGCTTGTCAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19545
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Nonsense |
546 |
3121 |
13 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41733641)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40649882 |
GRCz11 |
1 |
41352669 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCTGATGTGTAGGTGCTGGATGGCAGTGAGAGTCAGTACTCAGGGATG[C/T]AGATCGGCACACTGCAGGATGAGGAGGAGGAGGGCTCGGCTCCACCACCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39658
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Essential Splice Site |
1074 |
3121 |
26 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41721538)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40637779 |
GRCz11 |
1 |
41340566 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTACTGTTCTTTGTTTGTATTTAACGTGTTTTTGCACCTGCTTTTGTA[G/A]CTGTTGCACCCAAGTGCATGAAGAGTCCATGGGCAGGTGAGGAGGAGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38282
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Essential Splice Site |
2188 |
3121 |
49 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41697217)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40613458 |
GRCz11 |
1 |
41316245 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATATAGATACTCTGATTGCATATGTTTGTGTGTGTGTGTGTGTGTTGC[A/G]GGTGAGCCTGGGTTTTATCAGACTGTGTTGAGTCTGTGTGGCGTGTTGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45079
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Nonsense |
2330 |
3121 |
52 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41693844)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40610085 |
GRCz11 |
1 |
41312872 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAACATGAGTTGCTATGTCTGTGATTTTTAGACCAGCGTGAATGGCATTG[T/A]TGTGAGATCATGGCTGAGCTGGTTGAAGGTCTGCAGACTGTCCTGACTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19544
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Nonsense |
2714 |
3121 |
60 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41686043)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40602284 |
GRCz11 |
1 |
41305071 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGAACTGCAGAAGGTGCATCCACCAGAAGATGAGATCCTCAACCAATA[C/A]CTTGTTCCAGCAATCTGTAAAGCAGCAGCAGTGCTTGGCATGGTGAGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39657
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Nonsense |
2951 |
3121 |
65 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41679313)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40595554 |
GRCz11 |
1 |
41298341 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTAATCTGTGGCAATTTCTTGCGCCAGGATTCGCAAAGGTTTTCCGAGT[G/T]AGGCACGTGTTGTGGCCAGGATCCTTCCTCAGTTCCTGGATGACTTTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12352
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000074777 |
Nonsense |
3081 |
3121 |
67 |
67 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41676475)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
40592716 |
GRCz11 |
1 |
41295503 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CGGTGGACATTAGCCTCTTTTGCTTGRTCGCTATGGACTTCTACCGACAT[C/T]AGATCGATGAGGAGTTAGACCGCAGGGCCTTCCAGTCTGTCTTTGAGATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: