fsta

Ensembl ID:
ENSDARG00000052846
ZFIN ID:
ZDB-GENE-990714-11
Description:
Follistatin-A [Source:UniProtKB/Swiss-Prot;Acc:Q9YHV4]
Human Orthologue:
FST
Human Description:
follistatin [Source:HGNC Symbol;Acc:3971]
Mouse Orthologue:
Fst
Mouse Description:
follistatin Gene [Source:MGI Symbol;Acc:MGI:95586]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45219 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051065   296 322 5 5
ENSDART00000146237 Essential Splice Site 296 324 None 6
Genomic Location (Zv9):
Chromosome 5 (position 42132606)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39907323
GRCz11 5 40507476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCGCTCGGAGGAAGCTGTGTGCGCCAGCGACAACACCACGTATCCCAG[T/C]GAGTGTGCCATGAAGCAGGCCGCTTGCTCTTTGGGGGTTCTCCTGGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link