zgc:110105

Ensembl ID:
ENSDARG00000052833
ZFIN ID:
ZDB-GENE-050706-134
Description:
AN1-type zinc finger protein 3 [Source:RefSeq peptide;Acc:NP_001025346]
Human Orthologue:
ZFAND3
Human Description:
zinc finger, AN1-type domain 3 [Source:HGNC Symbol;Acc:18019]
Mouse Orthologue:
Zfand3
Mouse Description:
zinc finger, AN1-type domain 3 Gene [Source:MGI Symbol;Acc:MGI:1096572]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24944 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074761 Nonsense 180 226 6 6

The following transcripts of ENSDARG00000052833 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 45323175)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44566674
GRCz11 13 44703578
KASP Assay ID:
554-7306.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCATTATGATGCTTCTCTGTCTCTCTTGCTCCCAGGTTATGTGTTCTG[C/A]ATGTTGCACCGATTGCCAGAGCAGCACGACTGTATGTTTGACCATCTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insulin resistance/response: Genome-wide detection of allele specific copy number variation associated with insulin resistance in African Americans from the HyperGEN study. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link