smcr8a

Ensembl ID:
ENSDARG00000052818
ZFIN ID:
ZDB-GENE-071212-4
Human Orthologue:
SMCR8
Human Description:
Smith-Magenis syndrome chromosome region, candidate 8 [Source:HGNC Symbol;Acc:17921]
Mouse Orthologue:
Smcr8
Mouse Description:
Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45149 Nonsense Mutation detected in F1 DNA During 2018
sa31350 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074746 Nonsense 718 853 2 2
Genomic Location (Zv9):
Chromosome 3 (position 40253280)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40116640
GRCz11 3 40258498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTATTACAGAGCTGTCTCTCCGGCTGGATCCAGCATCCTCCACTCTT[T/A]GAATCGATACAGCCGTTACATAAGCATTTTGGACTGTGACAACAAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074746 Nonsense 779 853 2 2
Genomic Location (Zv9):
Chromosome 3 (position 40253464)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40116824
GRCz11 3 40258682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCACATTCAGGGTATGTTGACTCAGCTTACAGCCAAGGCCTTCCTTTA[T/G]ACATTCTGCCATCACATTCACCTTCCCATGGACATCAACGACCAGGGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link