
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
glrba
- Ensembl ID:
- ENSDARG00000052782
- ZFIN ID:
- ZDB-GENE-010410-2
- Human Orthologue:
- GLRB
- Human Description:
- glycine receptor, beta [Source:HGNC Symbol;Acc:4329]
- Mouse Orthologue:
- Glrb
- Mouse Description:
- glycine receptor, beta subunit Gene [Source:MGI Symbol;Acc:MGI:95751]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19479 | Essential Splice Site | Available for shipment | Available now |
sa11272 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19479
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102790 | Essential Splice Site | 249 | 400 | 7 | 10 |
- Genomic Location (Zv9):
- Chromosome 1 (position 20246646)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 20771057 GRCz11 1 21463994 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAAGAGGATATTAAATATGCAAACTGCACCAAGTTCTACCCTGGAACAG[G/A]TATGGATTGATGTAAATATATAAATACTTTGATATTTGCATTTATATTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11272
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102790 | Nonsense | 369 | 400 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 1 (position 20222074)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 20746485 GRCz11 1 21439422 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTGAACAGCCCCAAACGYATAGAGGCAGAGAAAATAAAGATGGCTGAG[A/T]AAGAGAAAGCCAGAGAAAAAGAGAACAAGACACCGGCTAAAACTAAYAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: