zgc:153932

Ensembl ID:
ENSDARG00000052779
ZFIN ID:
ZDB-GENE-070209-223
Description:
hypothetical protein LOC100009638 [Source:RefSeq peptide;Acc:NP_001076476]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22172 Nonsense Available for shipment Available now
sa15561 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074682 Nonsense 342 1121 6 17
ENSDART00000111449 Nonsense 341 1120 7 18
ENSDART00000139094 Nonsense 342 863 7 13
Genomic Location (Zv9):
Chromosome 12 (position 47090307)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 45975279
GRCz11 12 46135957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGAAGCACACTCGGTAGCTGGTATTGGGAGTCGTATATATGTGGATA[T/A]GATGACACTCTTGTAGAATGGGACGGCTGGTACAGACTCTTCATTAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074682 Essential Splice Site 759 1121 10 17
ENSDART00000111449 Essential Splice Site 758 1120 11 18
ENSDART00000139094 Essential Splice Site 759 863 11 13
Genomic Location (Zv9):
Chromosome 12 (position 47084899)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 45969871
GRCz11 12 46130549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAYGACCACAACAGAAACAGCAGCTGAAACCAGAACTATAATATTTG[G/A]TAACGTATACAKATATACATATAACACAAAACACAMATATATATATANNATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link