Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:158863
- Ensembl ID:
- ENSDARG00000052747
- ZFIN ID:
- ZDB-GENE-070112-902
- Description:
- G patch domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001074099]
- Human Orthologue:
- GPATCH3
- Human Description:
- G patch domain containing 3 [Source:HGNC Symbol;Acc:25720]
- Mouse Orthologue:
- Gpatch3
- Mouse Description:
- G patch domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2442492]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa32113 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32113
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000083534 | Nonsense | 382 | 669 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 16 (position 57123187)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 53705752 GRCz11 16 53592579 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCACAGCAT[C/A]ACAAAGAAAAGACACGCCCCCAACATCATGCATAATACAGGACACGCCCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
