zgc:113046

Ensembl ID:
ENSDARG00000052731
ZFIN ID:
ZDB-GENE-050417-473
Description:
hypothetical protein LOC550610 [Source:RefSeq peptide;Acc:NP_001017911]
Human Orthologue:
ANKRD31
Human Description:
ankyrin repeat domain 31 [Source:HGNC Symbol;Acc:26853]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26572 Nonsense Mutation detected in F1 DNA During 2018
sa40556 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074638 Nonsense 110 261 3 6
Genomic Location (Zv9):
Chromosome 5 (position 52689000)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50356196
GRCz11 5 51002789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGGACATGATCACTGACAGATCTATGTATATGGTGGTGGAAAAATA[T/A]CTGCAAAAGACTAAAAGCGATACTTTTACAGGTATAAACCTCAACCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074638 Nonsense 189 261 6 6
Genomic Location (Zv9):
Chromosome 5 (position 52696642)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50363838
GRCz11 5 51010431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCACTCAAATGTGATTATTATCTGTTTTCATTTTGCAGTGGAACCAT[C/A]AGCTCAGACCAGCACCAATGAACTTTTTGTGAGAAACCAAGAACAGGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link