TMC3

Ensembl ID:
ENSDARG00000052723
Description:
transmembrane channel-like 3 [Source:HGNC Symbol;Acc:22995]
Human Orthologue:
TMC3
Human Description:
transmembrane channel-like 3 [Source:HGNC Symbol;Acc:22995]
Mouse Orthologue:
Tmc3
Mouse Description:
transmembrane channel-like gene family 3 Gene [Source:MGI Symbol;Acc:MGI:2669033]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26896 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102468 Essential Splice Site 41 651 2 27
Genomic Location (Zv9):
Chromosome 7 (position 12484534)
Other Location(s):
Assembly Chromosome Position
GRCz11 7 11666829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATAGTGTGTGTTAAAAGCGCGCGCGCGCGTGTGTGTGTGTATGTGTTT[T/C]TCAGGCAAGCCAGAGAGATTGTTCTGAAGTATGAAGGCAGATTGACCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link