zgc:110727

Ensembl ID:
ENSDARG00000052721
ZFIN ID:
ZDB-GENE-050522-471
Description:
DNA primase large subunit [Source:RefSeq peptide;Acc:NP_999947]
Human Orthologue:
PRIM2
Human Description:
primase, DNA, polypeptide 2 (58kDa) [Source:HGNC Symbol;Acc:9370]
Mouse Orthologue:
Prim2
Mouse Description:
DNA primase, p58 subunit Gene [Source:MGI Symbol;Acc:MGI:97758]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8806 Nonsense Mutation detected in F1 DNA During 2018
sa8833 Nonsense Mutation detected in F1 DNA During 2018
sa12346 Essential Splice Site Available for shipment Available now
sa42193 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23832496)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23478156
GRCz11 13 23608606
KASP Assay ID:
2260-6370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCGTTAYMGRTTCGGGATTCTTTCTTCAAAGCACAAGACTGAGTTTT[T/A]GCATAAGAATAATTTGAAGTATGAGACGGTAAGGCTTTTAAAAATACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5
ENSDART00000005004 Nonsense 149 508 5 14
ENSDART00000136406 Nonsense 149 508 4 13
ENSDART00000146216 Nonsense 158 199 4 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23832496)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23478156
GRCz11 13 23608606
KASP Assay ID:
2260-6370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCGTTAYMGRTTCGGGATTCTTTCTTCAAAGCACAAGACTGAGTTTT[T/A]GCATAAGAATAATTTGAAGTATGAGACGGTAAGGCTTTTAAAAATACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Essential Splice Site 345 508 10 14
ENSDART00000136406 Essential Splice Site 345 508 9 13
ENSDART00000146216   None 199 None 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23765625)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23411285
GRCz11 13 23541735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGTTCTGGAGGTCAGAGTTTGTCAAGGGGAAAGTYGATGCAGACAAG[G/T]TAACTCTTCAACTTCAGCTTCTAACTCCCTCACATWGTCCTGGTTTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Essential Splice Site 345 508 10 14
ENSDART00000136406 Essential Splice Site 345 508 9 13
ENSDART00000146216   None 199 None 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23765624)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23411284
GRCz11 13 23541734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTTCTGGAGGTCAGAGTTTGTCAAGGGGAAAGTTGATGCAGACAAGG[T/C]AACTCTTCAACTTCAGCTTCTAACTCCCTCACATTGTCCTGGTTTTCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005004 Nonsense 370 508 11 14
ENSDART00000136406 Nonsense 370 508 10 13
ENSDART00000146216   None 199 None 5

The following transcripts of ENSDARG00000052721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23737395)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23383055
GRCz11 13 23513505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCGCCACATGTTTGGGAAGGAAGGCAAGCGCWCTGACTACACCCCCTA[C/A]AGTTGCATGAAGGTGATTTTGTMAAACCCACCCAGCCAAGGCGACTACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link