zgc:66488

Ensembl ID:
ENSDARG00000052717
ZFIN ID:
ZDB-GENE-040426-1645
Description:
F-box only protein 43 [Source:RefSeq peptide;Acc:NP_956725]
Human Orthologue:
FBXO43
Human Description:
F-box protein 43 [Source:HGNC Symbol;Acc:28521]
Mouse Orthologue:
Fbxo43
Mouse Description:
F-box protein 43 Gene [Source:MGI Symbol;Acc:MGI:1926053]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101209 Nonsense 345 557 5 8
Genomic Location (Zv9):
Chromosome 16 (position 58177721)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54844710
GRCz11 16 54652830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCGCGTGCTGGAGGAGGACGCCCCCTACAGGCCCAGGCTGCCGCTRT[C/G]AGGGCTMATCGGCCGGAAGAKGGGTCTGCAGACGCTAGATCTGATCTCWG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link