
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:114200
- Ensembl ID:
- ENSDARG00000052668
- ZFIN ID:
- ZDB-GENE-050913-96
- Description:
- gamma-secretase subunit APH-1A [Source:RefSeq peptide;Acc:NP_001025300]
- Human Orthologue:
- APH1B
- Human Description:
- anterior pharynx defective 1 homolog B (C. elegans) [Source:HGNC Symbol;Acc:24080]
- Mouse Orthologues:
- Aph1b, Aph1c
- Mouse Descriptions:
- anterior pharynx defective 1b homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3522097]
- anterior pharynx defective 1c homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1915568]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2562 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2562
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000074574 | Essential Splice Site | 203 | 253 | 5 | 7 |
ENSDART00000139993 | None | 188 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 10 (position 8377616)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 6390778 GRCz11 10 6391987 - KASP Assay ID:
- 554-3189.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGGGTCATTGCTGTCGTCGTCAGTCTTCACCTGTTAGTCGCTGGCCTGG[T/C]GAGATTTACATGAACACAAACTTTAATTGTCCTYGATCTGCTCTTCAACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: