zgc:114200

Ensembl ID:
ENSDARG00000052668
ZFIN ID:
ZDB-GENE-050913-96
Description:
gamma-secretase subunit APH-1A [Source:RefSeq peptide;Acc:NP_001025300]
Human Orthologue:
APH1B
Human Description:
anterior pharynx defective 1 homolog B (C. elegans) [Source:HGNC Symbol;Acc:24080]
Mouse Orthologues:
Aph1b, Aph1c
Mouse Descriptions:
anterior pharynx defective 1b homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3522097]
anterior pharynx defective 1c homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1915568]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2562 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa2562
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074574 Essential Splice Site 203 253 5 7
ENSDART00000139993   None 188 None 5
Genomic Location (Zv9):
Chromosome 10 (position 8377616)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6390778
GRCz11 10 6391987
KASP Assay ID:
554-3189.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGTCATTGCTGTCGTCGTCAGTCTTCACCTGTTAGTCGCTGGCCTGG[T/C]GAGATTTACATGAACACAAACTTTAATTGTCCTYGATCTGCTCTTCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link