Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
thrab
- Ensembl ID:
- ENSDARG00000052654
- ZFIN ID:
- ZDB-GENE-060613-1
- Description:
- TRalpha-B [Source:UniProtKB/TrEMBL;Acc:Q1L674]
- Human Orthologue:
- THRA
- Human Description:
- thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) [S
- Mouse Orthologue:
- Thra
- Mouse Description:
- thyroid hormone receptor alpha Gene [Source:MGI Symbol;Acc:MGI:98742]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa35284 | Essential Splice Site | Available for shipment | Available now |
| sa42021 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa42020 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35284
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074549 | Essential Splice Site | 21 | 391 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23189333)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 21712696 GRCz11 12 21833915 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCGAAAAGGAAGAGAAAGAACAGCCAGTGTTCGGTGAAGAGCATGTCAG[G/A]TAAGATGTCTGATAGAAGACTAGCTTTGTCTGAAATAACCTTGTTTCCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42021
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074549 | Nonsense | 74 | 391 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23178979)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 21702342 GRCz11 12 21823561 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAGGCGCACCATCCAGAAAAACCTTCATCCCTCTTATTCCTGTAAATA[C/A]GATGGCTGCTGCATTATTGACAAGATCACCCGCAACCAGTGCCAGCTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42020
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000074549 | Essential Splice Site | 309 | 391 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 12 (position 23154810)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 21678173 GRCz11 12 21799392 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAAAAAAGTTAAGTTTACAATCCTAAAGTTATTGCATCTTTTCTGGTCC[A/T]GATCGTACAGGTCTGACGTGTGTGGAGAAGATCGAGAAGTGCCAGGAGAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
