thrab

Ensembl ID:
ENSDARG00000052654
ZFIN ID:
ZDB-GENE-060613-1
Description:
TRalpha-B [Source:UniProtKB/TrEMBL;Acc:Q1L674]
Human Orthologue:
THRA
Human Description:
thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) [S
Mouse Orthologue:
Thra
Mouse Description:
thyroid hormone receptor alpha Gene [Source:MGI Symbol;Acc:MGI:98742]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35284 Essential Splice Site Available for shipment Available now
sa42021 Nonsense Mutation detected in F1 DNA During 2018
sa42020 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074549 Essential Splice Site 21 391 1 7
Genomic Location (Zv9):
Chromosome 12 (position 23189333)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21712696
GRCz11 12 21833915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGAAAAGGAAGAGAAAGAACAGCCAGTGTTCGGTGAAGAGCATGTCAG[G/A]TAAGATGTCTGATAGAAGACTAGCTTTGTCTGAAATAACCTTGTTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074549 Nonsense 74 391 3 7
Genomic Location (Zv9):
Chromosome 12 (position 23178979)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21702342
GRCz11 12 21823561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGCGCACCATCCAGAAAAACCTTCATCCCTCTTATTCCTGTAAATA[C/A]GATGGCTGCTGCATTATTGACAAGATCACCCGCAACCAGTGCCAGCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074549 Essential Splice Site 309 391 7 7
Genomic Location (Zv9):
Chromosome 12 (position 23154810)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21678173
GRCz11 12 21799392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAAAAGTTAAGTTTACAATCCTAAAGTTATTGCATCTTTTCTGGTCC[A/T]GATCGTACAGGTCTGACGTGTGTGGAGAAGATCGAGAAGTGCCAGGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link