ube2i2

Ensembl ID:
ENSDARG00000052649
ZFIN ID:
ZDB-GENE-010607-1
Description:
SUMO-conjugating enzyme UBC9-B [Source:UniProtKB/Swiss-Prot;Acc:Q9DDJ0]
Human Orthologue:
UBE2I
Human Description:
ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) [Source:HGNC Symbol;Acc:12485]
Mouse Orthologue:
Ube2i
Mouse Description:
ubiquitin-conjugating enzyme E2I Gene [Source:MGI Symbol;Acc:MGI:107365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20115 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052746 Nonsense 130 157 6 7
Genomic Location (Zv9):
Chromosome 3 (position 45410582)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47420135
GRCz11 3 45372469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAGGAATCCAAGAGCTCCTAAATGAACCAAATATTCAGGATCCCGCA[C/T]AGGCCGAGGCATACACGATTTACTGGTACGCTCCTCCGTTTCAAACTCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link