
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bsdc1
- Ensembl ID:
- ENSDARG00000052623
- ZFIN ID:
- ZDB-GENE-040905-1
- Description:
- BSD domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A2BIJ3]
- Human Orthologue:
- BSDC1
- Human Description:
- BSD domain containing 1 [Source:HGNC Symbol;Acc:25501]
- Mouse Orthologue:
- Bsdc1
- Mouse Description:
- BSD domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913466]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35585 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35585
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005195 | Essential Splice Site | 368 | 412 | None | 11 |
ENSDART00000074547 | Essential Splice Site | 185 | 229 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 46559244)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 45855113 GRCz11 13 45991837 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCAACTCAGACAGCGGCAAGTCCACACCCTCCAATAATGGCAAAAAAGG[T/G]GAGAGAGACCATATAGAATCTATAGAGAATGGGAATGTGTCGTAACTGCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: