zgc:152900

Ensembl ID:
ENSDARG00000052606
ZFIN ID:
ZDB-GENE-061013-777
Description:
dipeptidyl peptidase 9 [Source:RefSeq peptide;Acc:NP_001070781]
Human Orthologue:
DPP9
Human Description:
dipeptidyl-peptidase 9 [Source:HGNC Symbol;Acc:18648]
Mouse Orthologue:
Dpp9
Mouse Description:
dipeptidylpeptidase 9 Gene [Source:MGI Symbol;Acc:MGI:2443967]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16756 Essential Splice Site Available for shipment Available now
sa41296 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31680 Nonsense Available for shipment Available now
sa21384 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074495 Essential Splice Site 194 885 5 21
ENSDART00000123254 Essential Splice Site 170 861 5 21
Genomic Location (Zv9):
Chromosome 8 (position 49847564)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47699541
GRCz11 8 47688533
KASP Assay ID:
2260-1117.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAACAGCCTTTTCTACTGCCGTGATGGCGGCCATAACGGCTTCAYTG[T/C]GAGTCTAGTTTTTTGCTTTATTTTCCTGTGNNTYTTAGTTTTTACAYTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074495 Essential Splice Site 289 885 7 21
ENSDART00000123254 Essential Splice Site 265 861 7 21
Genomic Location (Zv9):
Chromosome 8 (position 49851344)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47703321
GRCz11 8 47692313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTGATCGCTTCACTGGATACTGGTGGTCTCCGGCTGCTACTGAAGG[T/G]TTGTTGAACGCCTAAACAGTCCATGTTGTCAGCATTTGAAGGTGGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074495 Nonsense 678 885 17 21
ENSDART00000123254 Nonsense 654 861 17 21
Genomic Location (Zv9):
Chromosome 8 (position 49866151)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47718128
GRCz11 8 47707120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTGCTTTGTTATTTAAAATATAGGTGCAGTTAGTAAACAACTCTTA[C/A]AAGGGTGTGAAGTATCTGCGTCTGAACACGTTAGCATCTCTGGGTTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074495 Nonsense 721 885 18 21
ENSDART00000123254 Nonsense 697 861 18 21
Genomic Location (Zv9):
Chromosome 8 (position 49873782)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47725759
GRCz11 8 47714751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAAAAATAATAATAGAAGTATTGTTATGTTCTTCTCAACCCTCAGGGG[C/T]AGGTGGAGATCGAAGATCAAGTGGAGGGGCTTCAGTTTGTGGCTGAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link