zgc:112973

Ensembl ID:
ENSDARG00000052553
ZFIN ID:
ZDB-GENE-050706-65
Description:
DNA ligase 3 [Source:RefSeq peptide;Acc:NP_001025345]
Human Orthologue:
LIG3
Human Description:
ligase III, DNA, ATP-dependent [Source:HGNC Symbol;Acc:6600]
Mouse Orthologue:
Lig3
Mouse Description:
ligase III, DNA, ATP-dependent Gene [Source:MGI Symbol;Acc:MGI:109152]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44623 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31480 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074426 Essential Splice Site 260 752 5 20
Genomic Location (Zv9):
Chromosome 5 (position 62535177)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60170176
GRCz11 5 60854907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCATACTGAATTGCAATCAGGATGACATGGTGCAAGACTTGGAACAG[G/A]TTTGTAGTGTAGCTTCGAAGGTTTAATTTAGAAAAGAGGAGAGATATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074426 Essential Splice Site 342 752 7 20
Genomic Location (Zv9):
Chromosome 5 (position 62537970)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 60172969
GRCz11 5 60857700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTTTGGTCAAACATGATTTGAAAATCAACTCAGGGGCGAAACACATG[T/A]AAGTGATGCTAGCAAATTGTTTTTAAGACGACTGGTACTAAGATACATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link