tia1

Ensembl ID:
ENSDARG00000052536
ZFIN ID:
ZDB-GENE-030131-1506
Description:
cytotoxic granule-associated RNA binding protein 1 [Source:RefSeq peptide;Acc:NP_997793]
Human Orthologue:
TIA1
Human Description:
TIA1 cytotoxic granule-associated RNA binding protein [Source:HGNC Symbol;Acc:11802]
Mouse Orthologue:
Tia1
Mouse Description:
cytotoxic granule-associated RNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:107914]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33725 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074400 Essential Splice Site 75 386 3 12

The following transcripts of ENSDARG00000052536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 58371973)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56292572
GRCz11 5 56962789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGCGGCCTCACTCGCAGCCATGAATGGGCGTAAAATAATGGGTAAGG[T/C]AAGCTATCGTATCTACAGGGTGAGTTGGGCTGGGACGGGAGGGTGGGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link