zgc:152952

Ensembl ID:
ENSDARG00000052512
ZFIN ID:
ZDB-GENE-061013-482
Description:
testis-specific gene 10 protein [Source:RefSeq peptide;Acc:NP_001070757]
Human Orthologue:
TSGA10
Human Description:
testis specific, 10 [Source:HGNC Symbol;Acc:14927]
Mouse Orthologue:
Tsga10
Mouse Description:
testis specific 10 Gene [Source:MGI Symbol;Acc:MGI:2685063]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31234 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074380 Essential Splice Site None 710 2 18
ENSDART00000101017 Essential Splice Site None 357 2 12
ENSDART00000108894   None 611 None 16
ENSDART00000135487   None 78 None 3

The following transcripts of ENSDARG00000052512 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 50159256)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49008437
GRCz11 1 49652857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGGTAGCTGTTGCTTTATGCTATAAACGCTAGGTTAATCTTTTAAAG[T/G]AGGTGTCTCATATGTATCTGTAATTTTCTTTACATCTGTATGTATGGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link