zgc:194158

Ensembl ID:
ENSDARG00000052437
ZFIN ID:
ZDB-GENE-081022-66
Description:
melanoma-derived growth regulatory protein [Source:RefSeq peptide;Acc:NP_001122226]
Human Orthologue:
MIA
Human Description:
melanoma inhibitory activity [Source:HGNC Symbol;Acc:7076]
Mouse Orthologue:
Mia1
Mouse Description:
melanoma inhibitory activity 1 Gene [Source:MGI Symbol;Acc:MGI:109615]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10638 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074290 Nonsense 37 132 1 4
Genomic Location (Zv9):
Chromosome 5 (position 59004018)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56984701
GRCz11 5 57654918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGATTCAAGCTGGCAGACACATGCCAAAACTCTCYGACAAGAAGMTATG[C/A]GCCGATTCAGAGTGTAGTCKTGAGTAACTCAAACATGCATCTTTAACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link