zgc:153929

Ensembl ID:
ENSDARG00000052427
ZFIN ID:
ZDB-GENE-061103-154
Description:
Bicaudal D-related protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A0JMK8]
Human Orthologue:
CCDC64B
Human Description:
coiled-coil domain containing 64B [Source:HGNC Symbol;Acc:33584]
Mouse Orthologue:
Ccdc64b
Mouse Description:
coiled-coil domain containing 64B Gene [Source:MGI Symbol;Acc:MGI:2388267]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa724 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074268 Essential Splice Site None 414 2 11
ENSDART00000124568   None 477 None 12
Genomic Location (Zv9):
Chromosome 5 (position 59008694)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56989366
GRCz11 5 57659583
KASP Assay ID:
554-0632.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGGTCAGGTCTACAAAAGAAGCTGCTAGACAACAGAGACGCCCAAAGG[T/A]AATACCGGATTATGTGTTGTTTCCTAGNNCACACATTTAGAGAAGAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link