zgc:162268

Ensembl ID:
ENSDARG00000052408
ZFIN ID:
ZDB-GENE-070410-54
Description:
alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase [Source:RefSeq peptide;Acc:N
Human Orthologue:
MGAT2
Human Description:
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Mgat2
Mouse Description:
mannoside acetylglucosaminyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2384966]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43553 Nonsense Mutation detected in F1 DNA During 2018
sa13134 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074255 Nonsense 229 450 2 2
Genomic Location (Zv9):
Chromosome 20 (position 54422996)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54278399
GRCz11 20 54067845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAGAGTACCCAGACTCCTTCGGCCACTACCGGGAGGCCAAATTCTCC[C/T]AAACCAAACACCATTGGTGGTGGAAACTGCACTTTGTGTGGGATCGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074255 Nonsense 448 450 2 2
Genomic Location (Zv9):
Chromosome 20 (position 54422339)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 54277742
GRCz11 20 54067188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCGGCTGGGGGGACATCAGGGACCATGAACTCTGCAAGAGCTACCTT[C/T]GATTACAGTGAACTTTATATATGATCTTCTTTTTGGTTGTTTTTTNGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link