zgc:136377

Ensembl ID:
ENSDARG00000052387
ZFIN ID:
ZDB-GENE-060512-299
Description:
POU transcription factor [Source:RefSeq peptide;Acc:NP_001038720]
Human Orthologue:
POU2F3
Human Description:
POU class 2 homeobox 3 [Source:HGNC Symbol;Acc:19864]
Mouse Orthologue:
Pou2f3
Mouse Description:
POU domain, class 2, transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:102565]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11296 Essential Splice Site Available for shipment Available now
sa20549 Nonsense Available for shipment Available now
sa38512 Nonsense Mutation detected in F1 DNA During 2018
sa33730 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38513 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044803 Essential Splice Site None 398 2 13
Genomic Location (Zv9):
Chromosome 5 (position 60019462)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57881080
GRCz11 5 58550789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCATARAGTTGTGATCCTGTAGGAAAATCAGCTGTATTTATCATTWC[A/T]GATATTAAGATGAGCACAGACGCTGTTGAGCWGACAGAATCTCAGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044803 Nonsense 225 398 8 13
Genomic Location (Zv9):
Chromosome 5 (position 60042162)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57903780
GRCz11 5 58573489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAAGCTCTCAATCTAAGCTTCAAAAACATGTGCAAGCTCAAGCCTT[T/A]ACTGGAAAAGTGGCTAAGTGATGCAGGTAAATGTGCTGCTGCCCTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044803 Nonsense 286 398 10 13
Genomic Location (Zv9):
Chromosome 5 (position 60048174)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57909792
GRCz11 5 58579501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTATAAATGCTTTTTGCCCAATCCAGAACCCAAAACCCAACTCTGAA[G/T]AGATTACGCTGATCTCAGAGCAGCTGGCCATGGAGAAGGAGGTGGTGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044803 Essential Splice Site 333 398 10 13
Genomic Location (Zv9):
Chromosome 5 (position 60048318)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57909936
GRCz11 5 58579645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGTTTCCACTTCACCCATAAAACCTCACAACTTCAACCCTCGTCTG[G/A]TAAGTCTGACAAATCATTTTTGAATGAGACACATGTCTGTCTGTTCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044803 Nonsense 389 398 13 13
Genomic Location (Zv9):
Chromosome 5 (position 60070053)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57931671
GRCz11 5 58601380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTAGTAAAACTGATGAAAAAACTGTTCTTTTCCCTCAGATCGTGGTA[T/A]CGCTGGAACACCGCCTCATACCATCACTGAGTCCCTTTGAAGTAGCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link