zgc:113045

Ensembl ID:
ENSDARG00000052383
ZFIN IDs:
ZDB-GENE-051113-64, ZDB-GENE-051113-64
Description:
transcription factor E2-alpha [Source:RefSeq peptide;Acc:NP_001166154]
Human Orthologue:
TCF3
Human Description:
transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Tcf3
Mouse Description:
transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:98510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43820 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074228 Nonsense 209 652 10 21
ENSDART00000130136 Nonsense 209 652 9 19
Genomic Location (Zv9):
Chromosome 22 (position 20646237)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20302390
GRCz11 22 20327368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATCCCTCCCATCTGCCTTTGTGTTCGCAGAAGGCCTACACTCATCTT[C/A]GGATCCCTGGGCCCCTTCCGGATCCTTAGGCCAGTCAGGATACACGGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link