zgc:114058

Ensembl ID:
ENSDARG00000052379
ZFIN ID:
ZDB-GENE-050913-93
Description:
Coiled-coil domain-containing protein 22 [Source:UniProtKB/Swiss-Prot;Acc:Q4V909]
Human Orthologue:
CCDC22
Human Description:
coiled-coil domain containing 22 [Source:HGNC Symbol;Acc:28909]
Mouse Orthologue:
Ccdc22
Mouse Description:
coiled-coil domain containing 22 Gene [Source:MGI Symbol;Acc:MGI:1859608]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41195 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34393 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099769 Essential Splice Site 416 639 9 16
Genomic Location (Zv9):
Chromosome 8 (position 24482297)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23608115
GRCz11 8 23629354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCATTGACCTTCTTCCTGACGCTGAAAACAACCTGCTCAAATTACAG[G/A]TACACAAATCATTCCACGTTCACATCTGCCATCATAAGGAAAACAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099769 Nonsense 587 639 15 16
Genomic Location (Zv9):
Chromosome 8 (position 24487258)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23613076
GRCz11 8 23634315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAACTTTTTTGTGCTCCCAGAACTGCACTCAGTTGATTCAGACCATC[G/T]AGGACACAGGAACCATCATGAGAGAAATCCGAGATCTGGAGGAACAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link