si:ch211-213b8.3

Ensembl ID:
ENSDARG00000052376
ZFIN ID:
ZDB-GENE-090312-192
Description:
si:ch211-213b8.3 [Source:RefSeq peptide;Acc:NP_998005]
Human Orthologue:
B3GNT2
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 [Source:HGNC Symbol;Acc:15629]
Mouse Orthologue:
B3gnt2
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:188950

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44515 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074221 Nonsense 166 412 1 1
Genomic Location (Zv9):
Chromosome 1 (position 54030487)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52841247
GRCz11 1 53475985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTTGCGCCACATTTCGACCGCCGGCAAGCCATTCGGGAATCGTGGGGA[C/T]GAGCTGGAATCCTCGATGGTCAGCGCATTGCTACAGTTTTCTTACTTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link