zgc:66455

Ensembl ID:
ENSDARG00000052375
ZFIN ID:
ZDB-GENE-040426-1642
Description:
hypothetical protein LOC393502 [Source:RefSeq peptide;Acc:NP_956824]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19607 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074218 Essential Splice Site 402 633 8 10
ENSDART00000143349 Essential Splice Site 409 640 8 10
Genomic Location (Zv9):
Chromosome 1 (position 54015585)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52826345
GRCz11 1 53461083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAGCTGATCTTGTTGATCTGCAGACGTTCTGACTGTGTGTGTTTTCA[G/T]GTTGAGTTCTGGTGTGTTGTTCATCGTGTGGCTGTGGTTGGAGAAGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link