
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
faf2
- Ensembl ID:
- ENSDARG00000052374
- ZFIN ID:
- ZDB-GENE-050208-312
- Description:
- Zgc:194819 protein [Source:UniProtKB/TrEMBL;Acc:B3DID0]
- Human Orthologue:
- FAF2
- Human Description:
- Fas associated factor family member 2 [Source:HGNC Symbol;Acc:24666]
- Mouse Orthologue:
- Faf2
- Mouse Description:
- Fas associated factor family member 2 Gene [Source:MGI Symbol;Acc:MGI:1923827]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42443 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42443
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029797 | Nonsense | 211 | 445 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 14 (position 47707113)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 45854357 GRCz11 14 51005589 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGAAGAGGCGCTCACCTTCATCAACACGAGGATGTTGTTCTGGGCATG[T/A]TCCACCAGCAAACCAGAGGGTTACAGAGGTGAACCAGCTGCACTTCATAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: