smarca5

Ensembl ID:
ENSDARG00000052348
ZFIN ID:
ZDB-GENE-021125-1
Description:
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 [Sour
Human Orthologue:
SMARCA5
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 [S
Mouse Orthologue:
Smarca5
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Ge

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14090 Essential Splice Site Available for shipment Available now
sa19604 Essential Splice Site Available for shipment Available now
sa32777 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11295 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024215 Essential Splice Site 339 1028 8 24
ENSDART00000123972 Essential Splice Site 346 1035 8 24
Genomic Location (Zv9):
Chromosome 1 (position 53293161)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52162732
GRCz11 1 52797470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGCGCTGCTCAACTTCCTGCTGCCAGATGTTTTCAACTCCTCCGAGG[T/G]GACACTTTCTGTCAATTTGATGGATTCTATACYGTCCAGCTTTATTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024215 Essential Splice Site 340 1028 9 24
ENSDART00000123972 Essential Splice Site 347 1035 9 24
Genomic Location (Zv9):
Chromosome 1 (position 53294285)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52163856
GRCz11 1 52798594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTAATGTGTAAAGAGTAATTATAGACTAACGTTTTATCTTTGTGCA[G/T]GATTTTGATGCCTGGTTTGACACCAACAACTGTCTGGGTGACACAAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024215 Essential Splice Site 736 1028 17 24
ENSDART00000123972 Essential Splice Site 743 1035 17 24
Genomic Location (Zv9):
Chromosome 1 (position 53310244)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52179815
GRCz11 1 52814553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTACTTTCGAGAAGCCCTGCGCGTCAGCGAGCCCAAAGCACCAAAGG[T/C]ATTATTAGCCCTTTAACTCATCGCTGACTAAATCAGTGTTTTAATTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024215 Essential Splice Site 860 1028 20 24
ENSDART00000123972 Essential Splice Site 867 1035 20 24
Genomic Location (Zv9):
Chromosome 1 (position 53312213)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52181784
GRCz11 1 52816522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGTGAGGTTGAGGGCAAAACCCCAGAGGAGGTCATGGAATATTCTGG[T/A]ACGTCAAARGGTTTTACACCACYTTAYTGATGAGCTTTATTTCAAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link