zgc:154116

Ensembl ID:
ENSDARG00000052326
ZFIN ID:
ZDB-GENE-061013-84
Description:
beta-1,4-galactosyltransferase 1 [Source:RefSeq peptide;Acc:NP_001070727]
Human Orthologue:
B4GALT1
Human Description:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 [Source:HGNC Symbol;Acc:924]
Mouse Orthologue:
B4galt1
Mouse Description:
UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:95

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9983 Nonsense Available for shipment Available now
sa10720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9983
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074158 Nonsense 329 350 6 6
ENSDART00000074158 Nonsense 329 350 6 6
Genomic Location (Zv9):
Chromosome 14 (position 53512588)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51751167
GRCz11 14 52466861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCACACRAGGGAAACCATGGCAACTGAYGGGATCAATTCGCTAAAATA[T/A]AACGTKGTAAAAATCGAGAAAGACCTGCTCTTCACCAAAATCACAGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074158 Nonsense 329 350 6 6
ENSDART00000074158 Nonsense 329 350 6 6
Genomic Location (Zv9):
Chromosome 14 (position 53512588)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51751167
GRCz11 14 52466861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCACACRAGGGAAACCATGGCAACTGAYGGGATCAATTCGCTAAAATA[T/A]AACGTKGTAAAAATCGAGAAAGACCTGCTCTTCACCAAAATCACAGTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link