zgc:103471

Ensembl ID:
ENSDARG00000052307
ZFIN ID:
ZDB-GENE-041212-36
Description:
Probable lysosomal cobalamin transporter [Source:UniProtKB/Swiss-Prot;Acc:Q5PR61]
Human Orthologue:
LMBRD1
Human Description:
LMBR1 domain containing 1 [Source:HGNC Symbol;Acc:23038]
Mouse Orthologue:
Lmbrd1
Mouse Description:
LMBR1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915671]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42270 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9221 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074131 Essential Splice Site 306 541 9 16
ENSDART00000100361 Essential Splice Site 306 541 9 16
ENSDART00000133265   None 213 None 7

The following transcripts of ENSDARG00000052307 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 39083472)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38560284
GRCz11 13 38686174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGAAACTGCTGCAACAAAGTGGGCTCTGCTCTCCGTCCCATGAAGG[T/A]GTGTTTGAGTTTTACCTCTGAATTGCTTCAGTGACTTTCAGTGACTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074131 Nonsense 435 541 13 16
ENSDART00000100361 Nonsense 435 541 13 16
ENSDART00000133265   None 213 None 7

The following transcripts of ENSDARG00000052307 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 39061128)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 38537940
GRCz11 13 38663830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCCTCCTCATCGTCCTCCACACCAGCTACATGATCTACAGTCTGGCCCCG[C/T]AATACGTCATGTACGGCAGCCAGAAATACCTGCTGCAGGTGAGCYGTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link