zgc:171489

Ensembl ID:
ENSDARG00000052300
ZFIN ID:
ZDB-GENE-080303-25
Description:
hypothetical protein LOC100142644 [Source:RefSeq peptide;Acc:NP_001116092]
Mouse Orthologue:
4933427G17Rik
Mouse Description:
RIKEN cDNA 4933427G17 gene Gene [Source:MGI Symbol;Acc:MGI:1921716]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40185 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31364 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074129 Essential Splice Site 341 460 3 6
ENSDART00000074129 Essential Splice Site 341 460 3 6
Genomic Location (Zv9):
Chromosome 3 (position 59331199)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58407784
GRCz11 3 58462565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCCCACACAACTACTACTTCCTCGCATTGTTCCTCACTTCCAACATG[T/G]AAGTATTTACACTGCTCTTTGTGTCCTGCTCTGGGCTAAAGGGAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074129 Essential Splice Site 341 460 3 6
ENSDART00000074129 Essential Splice Site 341 460 3 6
Genomic Location (Zv9):
Chromosome 3 (position 59331199)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58407784
GRCz11 3 58462565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCCCACACAACTACTACTTCCTCGCATTGTTCCTCACTTCCAACATG[T/G]AAGTATTTACACTGCTCTTTGTGTCCTGCTCTGGGCTAAAGGGAAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link