zgc:56005

Ensembl ID:
ENSDARG00000052279
ZFIN ID:
ZDB-GENE-040426-864
Description:
oxidative stress-induced growth inhibitor 1 [Source:RefSeq peptide;Acc:NP_956480]
Human Orthologue:
OSGIN1
Human Description:
oxidative stress induced growth inhibitor 1 [Source:HGNC Symbol;Acc:30093]
Mouse Orthologue:
Osgin1
Mouse Description:
oxidative stress induced growth inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1919089]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8499 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074100 Essential Splice Site 129 514 4 6
ENSDART00000127312 Essential Splice Site 129 514 3 5
Genomic Location (Zv9):
Chromosome 6 (position 50650933)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 50700411
GRCz11 6 50699630
KASP Assay ID:
2259-8146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACCRCACCTCGTRCKTGGAAAAGGACCACCTGGAGGGGCSTGGCATG[T/C]AAGTGACCACTCCTAAAATACTTCTRTCTCCTGATTTTAAATCCCTATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link