slc22a18

Ensembl ID:
ENSDARG00000052271
ZFIN ID:
ZDB-GENE-051120-165
Description:
solute carrier family 22 member 18 [Source:RefSeq peptide;Acc:NP_001032462]
Human Orthologue:
SLC22A18
Human Description:
solute carrier family 22, member 18 [Source:HGNC Symbol;Acc:10964]
Mouse Orthologue:
Slc22a18
Mouse Description:
solute carrier family 22 (organic cation transporter), member 18 Gene [Source:MGI Symbol;Acc:MGI:133

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34133 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21035 Essential Splice Site Available for shipment Available now
sa34132 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074093   None 400 None 10
ENSDART00000134174 Essential Splice Site None 136 1 5
ENSDART00000143040   None 401 None 10
Genomic Location (Zv9):
Chromosome 7 (position 40944837)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39281094
GRCz11 7 39552111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGTGTTCTTGTTCGGGGATGAAACGATAACATCTTTTATTGAGTACC[G/T]TAAGTCTTTGCAAATATCAATACGTTAGTGTAAATAATATAAAGACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074093 Essential Splice Site 299 400 8 10
ENSDART00000134174   None 136 None 5
ENSDART00000143040 Essential Splice Site 300 401 8 10
Genomic Location (Zv9):
Chromosome 7 (position 40934153)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39270410
GRCz11 7 39541427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTACTGCTGCTATCTGTTGGGGTTTCTAGTCTAGTGGGCCTTGCACAG[G/A]TAAACTGCTATCGGGCTCCTTACTTTTTCTTTTTTTTTACAGTAGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074093 Essential Splice Site 299 400 8 10
ENSDART00000134174   None 136 None 5
ENSDART00000143040 Essential Splice Site 300 401 8 10
Genomic Location (Zv9):
Chromosome 7 (position 40934152)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39270409
GRCz11 7 39541426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTGCTGCTATCTGTTGGGGTTTCTAGTCTAGTGGGCCTTGCACAGG[T/C]AAACTGCTATCGGGCTCCTTACTTTTTCTTTTTTTTTACAGTAGTGTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link