Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eif2s1
- Ensembl ID:
- ENSDARG00000052178
- ZFIN ID:
- ZDB-GENE-030131-283
- Description:
- eukaryotic translation initiation factor 2, subunit 1 alpha [Source:RefSeq peptide;Acc:NP_571875]
- Human Orthologue:
- EIF2S1
- Human Description:
- eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa [Source:HGNC Symbol;Acc:3265]
- Mouse Orthologue:
- Eif2s1
- Mouse Description:
- eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI Symbol;Acc:MGI:95299]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa23820 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23820
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000073981 | Essential Splice Site | 158 | 315 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 20 (position 51447027)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 51299096 GRCz11 20 51112316 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACAAGAAGCCTGGATACGGGGCCTACGACGTCTTTAAACAAGCTGTGTC[G/A]TGAGTCTAAGAGCACTAAAACACAAAAGCCCCTTTCACACATGCATCCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
