zgc:171711

Ensembl ID:
ENSDARG00000052176
ZFIN ID:
ZDB-GENE-070928-25
Description:
UPF0515 protein C19orf66 homolog [Source:UniProtKB/Swiss-Prot;Acc:A7YY07]
Human Orthologue:
C19orf66
Human Description:
chromosome 19 open reading frame 66 [Source:HGNC Symbol;Acc:25649]
Mouse Orthologue:
A230050P20Rik
Mouse Description:
RIKEN cDNA A230050P20 gene Gene [Source:MGI Symbol;Acc:MGI:2441788]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20145 Nonsense Available for shipment Available now
sa6919 Nonsense Mutation detected in F1 DNA During 2018
sa17310 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073978 Nonsense 36 327 2 10
Genomic Location (Zv9):
Chromosome 3 (position 54146120)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53253435
GRCz11 3 53508098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTTCATGGACTAATAGAAATCGACACGGCTGTGCTGCTTATGCGA[C/T]GATATGTGAAAAACCATCGTATGGTTGCAATGTGGATCGCCCTGATGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073978 Nonsense 242 327 9 10
Genomic Location (Zv9):
Chromosome 3 (position 54130312)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53237627
GRCz11 3 53492290
KASP Assay ID:
554-4648.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATRAAGATTCTACCACCAAGAAGGAARAACATGATGCCTGGGCCGARA[C/T]AAMGAAACCAGCACAGCTGCTTYGCTGAAGACTGTTATCATCGAATGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073978 Nonsense 243 327 9 10
Genomic Location (Zv9):
Chromosome 3 (position 54130309)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 53237624
GRCz11 3 53492287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAAGATTCTACCACCAAGAAGGAARAACAKGATGCCTGGGCCGARAYAA[C/T]GAAACCAGCACAGCTGCTTYGCTGAAGACTGTTATCATCGAATGGGTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link