uap1

Ensembl ID:
ENSDARG00000052170
ZFIN ID:
ZDB-GENE-030131-1233
Description:
UDP-N-acetylhexosamine pyrophosphorylase [Source:RefSeq peptide;Acc:NP_997786]
Human Orthologue:
UAP1
Human Description:
UDP-N-acteylglucosamine pyrophosphorylase 1 [Source:HGNC Symbol;Acc:12457]
Mouse Orthologue:
Uap1
Mouse Description:
UDP-N-acetylglucosamine pyrophosphorylase 1 Gene [Source:MGI Symbol;Acc:MGI:1334459]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33895 Nonsense Mutation detected in F1 DNA During 2018
sa1902 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa33895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073970 Nonsense 118 504 3 10
ENSDART00000132788 Nonsense 118 277 2 4
ENSDART00000143649   None 244 None 7

The following transcripts of ENSDARG00000052170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 34697781)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35065706
GRCz11 6 35049089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAGCAGTTCTTCTCTTGGCTGGAGGTCAAGGGACACGGTTGGGGGTAT[C/A]ATTTCCAAAAGGCATGTATGATGTGGGCCTGCCTTCCCACAAAACCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1902
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073970 Nonsense 298 504 6 10
ENSDART00000132788   None 277 None 4
ENSDART00000143649 Nonsense 24 244 2 7

The following transcripts of ENSDARG00000052170 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 34704663)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35058824
GRCz11 6 35042207
KASP Assay ID:
554-1892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAATCCCACAGAAGCAGTGGGTGTGGTCTGTAAGGTGGACGGCCGTTA[T/A]CAAGTTGTAGAGTATAGTGAGATTACCCTGGCAACGGCGGAGAAGAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link