ZNF507

Ensembl ID:
ENSDARG00000052164
Description:
zinc finger protein 507 [Source:HGNC Symbol;Acc:23783]
Human Orthologue:
ZNF507
Human Description:
zinc finger protein 507 [Source:HGNC Symbol;Acc:23783]
Mouse Orthologue:
Zfp507
Mouse Description:
zinc finger protein 507 Gene [Source:MGI Symbol;Acc:MGI:1916378]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40988 Nonsense Mutation detected in F1 DNA During 2018
sa40989 Nonsense Mutation detected in F1 DNA During 2018
sa45292 Nonsense Mutation detected in F1 DNA During 2018
sa34162 Nonsense Mutation detected in F1 DNA During 2018
sa34163 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098942 Nonsense 34 910 1 8
Genomic Location (Zv9):
Chromosome 7 (position 48705538)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46973157
GRCz11 7 47246236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGACACAGTCTTCATTCCCGACAGATGTCTTCTTGGTGTCGAGGAC[C/T]AGCAACGCCAGCAGCAGAAGCAGGCCGCTGACTCTCTTATTCAGGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098942 Nonsense 136 910 1 8
Genomic Location (Zv9):
Chromosome 7 (position 48705844)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46973463
GRCz11 7 47246542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAAGTCCAGGTGCCCGGACTGTTACGTGCTACCAGTGCAGTATGTGT[C/T]GATTTATATCTCCTACGTTGGAGCAGTTGAAAGAGCATCTGCTCTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098942 Nonsense 144 910 1 8
Genomic Location (Zv9):
Chromosome 7 (position 48705868)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46973487
GRCz11 7 47246566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACGTGCTACCAGTGCAGTATGTGTCGATTTATATCTCCTACGTTGGAG[C/T]AGTTGAAAGAGCATCTGCTCTGTCATGACGAGCAGCACAGCGACCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098942 Nonsense 611 910 3 8
Genomic Location (Zv9):
Chromosome 7 (position 48707361)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46974980
GRCz11 7 47248059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTGCTGTGTCTGGTGATGTTTCTACTGCAGACAGTCTGGTTGAATA[C/A]ATCGCTGGGAGCGAGAGGCCCTACCGCTGTAGATTGTGCCTCTACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098942 Nonsense 792 910 6 8
Genomic Location (Zv9):
Chromosome 7 (position 48714303)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46981922
GRCz11 7 47255001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCCACCCACCCTCTCTCAAATCCCACATGTGGAAACATGCTGGAGAT[C/T]AGAATTATAACTATGAGCAAGTCAACAAGGCCATCAACGAGGCCATTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link