il23r

Ensembl ID:
ENSDARG00000052158
ZFIN ID:
ZDB-GENE-080107-5
Description:
interleukin 23 receptor [Source:RefSeq peptide;Acc:NP_001106978]
Human Orthologue:
IL12RB2
Human Description:
interleukin 12 receptor, beta 2 [Source:HGNC Symbol;Acc:5972]
Mouse Orthologue:
Il12rb2
Mouse Description:
interleukin 12 receptor, beta 2 Gene [Source:MGI Symbol;Acc:MGI:1270861]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33896 Nonsense Mutation detected in F1 DNA During 2018
sa40728 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20741 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073956 Nonsense 201 818 5 13
Genomic Location (Zv9):
Chromosome 6 (position 34949400)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34892128
GRCz11 6 34875511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTGCCCGCAACATGAACTGACTATTTTATTCCATCTTCCAGAGCTAT[A/T]GACCAGAATATTACAATGGAGAATTATTATATTACAAGTTGTCCTATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073956 Essential Splice Site 329 818 7 13
Genomic Location (Zv9):
Chromosome 6 (position 34947121)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34894407
GRCz11 6 34877790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTGAGGGTAAAACTAATGTCCTTGAACTGTTCTGAAACTCTTTTGC[A/T]GGTATGCAAGCTGGTGTCTTGTATAATTTTTCTTTGTATGCTGAAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073956 Essential Splice Site 412 818 8 13
Genomic Location (Zv9):
Chromosome 6 (position 34945255)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34896273
GRCz11 6 34879656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTACACCATTTACTTCCAGAGGCACAGAGACAAGCCACTTGAAACCC[G/A]TGAGTAAAAACTTGTTTATGAGTGTGACGGCTGTGGTTTGTGTCTATATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link