notch3
- Ensembl ID:
- ENSDARG00000052139
- ZFIN ID:
- ZDB-GENE-000329-5
- Description:
- neurogenic locus notch homolog protein 3 [Source:RefSeq peptide;Acc:NP_571624]
- Human Orthologue:
- NOTCH3
- Human Description:
- notch 3 [Source:HGNC Symbol;Acc:7883]
- Mouse Orthologue:
- Notch3
- Mouse Description:
- Notch gene homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:99460]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa33321 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa14943 |
Essential Splice Site |
Available for shipment |
Available now |
sa16743 |
Nonsense |
Available for shipment |
Available now |
sa20147 |
Nonsense |
Available for shipment |
Available now |
sa40169 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa33320 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa33321
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000073930 |
Nonsense |
14 |
2468 |
1 |
33 |
- Genomic Location (Zv9):
- Chromosome 3 (position 54197153)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
53304468 |
GRCz11 |
3 |
53559131 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACAAAAATATGGGGAATTACAGCCTTTGGATATTTTTGTCAATTTTATA[T/A]CTGGTGCACAACAGCGAAGGTAAGATGACTGATCCTTTTCTTCATTTTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14943
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000073930 |
Essential Splice Site |
511 |
2468 |
10 |
33 |
- Genomic Location (Zv9):
- Chromosome 3 (position 54180245)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
53287560 |
GRCz11 |
3 |
53542223 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- NNNNNNNNNNNNNNNNNNNNNCACCGACCTAATGGATATGAATGCCGMTGTGCTGAAG[G/A]TAAGTTTATAAATCAATATATCAATGCAATTGTGTGTTTAAGGATCTATY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16743
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000073930 |
Nonsense |
607 |
2468 |
12 |
33 |
- Genomic Location (Zv9):
- Chromosome 3 (position 54178688)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
53286003 |
GRCz11 |
3 |
53540666 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACCAACTGTGAAATCAACTTTGACGACTGTGCYAGCAACCCTTGTGACTA[C/A]GGAATTTGCAAAGATGGCATAAATCGCTATGAGTGTGTCWGCAAACCTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20147
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000073930 |
Nonsense |
1377 |
2468 |
24 |
33 |
- Genomic Location (Zv9):
- Chromosome 3 (position 54172611)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
53279926 |
GRCz11 |
3 |
53534589 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGCTATCCATTTTTTCACTGCCAGTGCACCAATGGCTGGAAAGGCAAA[C/T]GATGTGAACAGAAAACTGGGTCATCGGCTCCACTTCCTTCTCCTTGCCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40169
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000073930 |
Nonsense |
1384 |
2468 |
24 |
33 |
- Genomic Location (Zv9):
- Chromosome 3 (position 54172589)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
53279904 |
GRCz11 |
3 |
53534567 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGTGCACCAATGGCTGGAAAGGCAAACGATGTGAACAGAAAACTGGGT[C/A]ATCGGCTCCACTTCCTTCTCCTTGCCCTATTGCTGACTGCTTCAGCAAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33320
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000073930 |
Nonsense |
1497 |
2468 |
25 |
33 |
- Genomic Location (Zv9):
- Chromosome 3 (position 54172167)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
53279482 |
GRCz11 |
3 |
53534145 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATGCAGATGGACTCTGTGATCAAGGATGCAATACTGAAGAATGTGGCTG[G/A]GATGGACTGGATTGTGCAAGGAAGATTCCAGAAGACCTTGCTGAAGATAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: