slc1a2a

Ensembl ID:
ENSDARG00000052138
ZFIN ID:
ZDB-GENE-100422-11
Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2a [Source:RefSeq pepti
Human Orthologue:
SLC1A2
Human Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Slc1a2
Mouse Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2 Gene [Source:MGI Symbo

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34174 Nonsense Mutation detected in F1 DNA During 2018
sa41004 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30892 Essential Splice Site Mutation detected in F1 DNA During 2018
sa729 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Nonsense 19 548 1 10
Genomic Location (Zv9):
Chromosome 7 (position 51322094)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49592330
GRCz11 7 49865106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCAAGTGGAGATCAGAATGCATGAGAATCATCTGGATCCTCTTCCA[G/T]AGCCTGAAGAGTCCATATGTGGAAGCTGCTGTGACAAACTCATGAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Essential Splice Site 224 548 5 10
ENSDART00000073932 Essential Splice Site 224 548 5 10
Genomic Location (Zv9):
Chromosome 7 (position 51327058)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49597294
GRCz11 7 49870070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCATTAACGTACATCGCATTAAGATGATGTGTTATGTGTTCTTGTA[G/A]GTATCATTGGTTTCTTTGTGGCATTTGGGATTTGCATGGGAAAGATGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Essential Splice Site 224 548 5 10
ENSDART00000073932 Essential Splice Site 224 548 5 10
Genomic Location (Zv9):
Chromosome 7 (position 51327058)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49597294
GRCz11 7 49870070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCATTAACGTACATCGCATTAAGATGATGTGTTATGTGTTCTTGTA[G/A]GTATCATTGGTTTCTTTGTGGCATTTGGGATTTGCATGGGAAAGATGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073932 Essential Splice Site 344 548 6 10
ENSDART00000073932 Essential Splice Site 344 548 6 10
Genomic Location (Zv9):
Chromosome 7 (position 51329922)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49600158
GRCz11 7 49872934
KASP Assay ID:
554-0636.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGGGACTTTTCCAAGCTTGGGTCACCGCCTTAGGAACAGCTTCCAGG[T/C]TAGTCACTTTCCTTTAATTATGTTTTCCCTTAGATATTTGTATGACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link