accs

Ensembl ID:
ENSDARG00000052124
ZFIN ID:
ZDB-GENE-050327-39
Description:
1-aminocyclopropane-1-carboxylate synthase-like protein 1 [Source:RefSeq peptide;Acc:NP_001014345]
Human Orthologues:
ACCS, ACCSL
Human Descriptions:
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional) [Source:HGNC Symbol
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like [Source:HGNC S
Mouse Orthologues:
Accs, Accsl
Mouse Descriptions:
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional) Gene [Source:MGI Sy
1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like Gene [Source:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31107 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073914 Essential Splice Site 370 556 13 14
ENSDART00000128591 Essential Splice Site 730 916 14 15

The following transcripts of ENSDARG00000052124 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 9175109)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8869772
GRCz11 25 8946840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGCTCTTTTGCATCAGCTTTCTGCATCCGGTCACTGTGTTTTCTGTA[G/A]TTTCTGAAGGAGAAGACGTTTGCAGAGGAGCTGTGTGTGTGGAGGTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link