ADAMTSL5

Ensembl ID:
ENSDARG00000052118
Description:
ADAMTS-like 5 [Source:HGNC Symbol;Acc:27912]
Human Orthologue:
ADAMTSL5
Human Description:
ADAMTS-like 5 [Source:HGNC Symbol;Acc:27912]
Mouse Orthologue:
Adamtsl5
Mouse Description:
ADAMTS-like 5 Gene [Source:MGI Symbol;Acc:MGI:1913798]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41007 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073910 Nonsense 3 538 1 13
Genomic Location (Zv9):
Chromosome 7 (position 51973035)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50243271
GRCz11 7 50516047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCGGTTTTTAAGATATTTTGAAAGTCGTGACGAAGACCTACAATGCAG[A/T]AGTCAAATTACAGGTATGTGGATCTTAAACTTGTGCTTGTCTGTGTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link