zgc:114041

Ensembl ID:
ENSDARG00000052109
ZFIN ID:
ZDB-GENE-050706-122
Description:
hypothetical protein LOC574425 [Source:RefSeq peptide;Acc:NP_001025143]
Human Orthologues:
AC037487.1, SLC16A1, SLC16A3, SLC16A5, SLC16A6, SLC16A7, SLC16A8
Human Descriptions:
solute carrier family 16, member 1 (monocarboxylic acid transporter 1) [Source:HGNC Symbol;Acc:10922
solute carrier family 16, member 3 (monocarboxylic acid transporter 4) [Source:HGNC Symbol;Acc:10924
solute carrier family 16, member 5 (monocarboxylic acid transporter 6) [Source:HGNC Symbol;Acc:10926
solute carrier family 16, member 6 (monocarboxylic acid transporter 7) [Source:HGNC Symbol;Acc:10927
solute carrier family 16, member 7 (monocarboxylic acid transporter 2) [Source:HGNC Symbol;Acc:10928
solute carrier family 16, member 8 (monocarboxylic acid transporter 3) [Source:HGNC Symbol;Acc:16270
Mouse Orthologues:
Slc16a1, Slc16a3, Slc16a5, Slc16a6, Slc16a7, Slc16a8
Mouse Descriptions:
solute carrier family 16 (monocarboxylic acid transporters), member 1 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 3 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 5 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 6 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 7 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 8 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33756 Nonsense Available for shipment Available now
sa942 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa33756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073892 Nonsense 167 433 4 5
Genomic Location (Zv9):
Chromosome 5 (position 69128813)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65462078
GRCz11 5 66141183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTGGCATGGCCTTCAGCCCGTTTTTCCAGTGGCTCATTGAAAGCTA[C/A]TCCTGGCGGGGCGCTCTTCTGGTCATCGGCGGTCTCCAGCTCAATCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa942
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073892 Nonsense 219 433 4 5
Genomic Location (Zv9):
Chromosome 5 (position 69128967)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65462232
GRCz11 5 66141337
KASP Assay ID:
554-0847.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTGGACTCAAAAGAGGAAACCRGGACATCCAAAAAAGTMACTTTC[C/T]AATGTTCTCTCATTCAGAGGYCTGAGCTGCTGMTTTATATTGTGTTCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link