Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rbpjb
- Ensembl ID:
- ENSDARG00000052091
- ZFIN ID:
- ZDB-GENE-070319-1
- Description:
- recombining binding protein suppressor of hairless [Source:RefSeq peptide;Acc:NP_001077020]
- Human Orthologue:
- RBPJ
- Human Description:
- recombination signal binding protein for immunoglobulin kappa J region [Source:HGNC Symbol;Acc:5724]
- Mouse Orthologues:
- Rbpj, Rbpsuh-rs3
- Mouse Descriptions:
- recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:M
- recombining binding protein suppressor of hairless (Drosophila), related sequence 3 Pseudogene [Sour
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa8403 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa34217 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8403
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000092580 | Nonsense | 26 | 491 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 62818943)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 61866141 GRCz11 7 62176303 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATGTGTTTCCTTTCTTTCTGCNTATTTTYCAGAGAAGCCATGCGAAATTA[C/A]CTGAAGGAACGAGGAGACCAAACTGTGCTCATCCTACACGCTAAAGTTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34217
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000092580 | Essential Splice Site | 383 | 491 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 62846168)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 61893366 GRCz11 7 62203528 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAACTCTGCGGGTGTGGTTTGGTGATGTAGAGGCAGAGACCATGTACAG[G/A]TATAGATTTGAGAAGATATACATATATGTATTGTTACGTCCTATAAAGCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Rheumatoid arthritis: Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
