zgc:174928

Ensembl ID:
ENSDARG00000052086
ZFIN ID:
ZDB-GENE-080220-14
Description:
hypothetical protein LOC792701 [Source:RefSeq peptide;Acc:NP_001107099]
Human Orthologue:
ZNF473
Human Description:
zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
Mouse Orthologue:
Zfp473
Mouse Description:
zinc finger protein 473 Gene [Source:MGI Symbol;Acc:MGI:2442697]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25708 Nonsense Mutation detected in F1 DNA During 2018
sa19631 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073833   None 524 None 4
ENSDART00000073836 Nonsense 329 491 7 7
ENSDART00000073862 Nonsense 173 346 2 2
ENSDART00000127718 Nonsense 487 650 3 3
ENSDART00000127941   None 174 None 4
Genomic Location (Zv9):
Chromosome 1 (position 59172527)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57882179
GRCz11 1 58617861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCCTACATGAAGAACCACATCCGCATTCACACCAACGAGAGGCCGTA[C/A]CAGTGCAGCGAGTGCGGAAAAACCTTCAAAACAAACAACTCTCTAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073833   None 524 None 4
ENSDART00000073836 Nonsense 452 491 7 7
ENSDART00000073862 Nonsense 296 346 2 2
ENSDART00000127718 Nonsense 610 650 3 3
ENSDART00000127941   None 174 None 4
Genomic Location (Zv9):
Chromosome 1 (position 59172160)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57882546
GRCz11 1 58618228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGGAGAAAGACCCTATAAATGTTCACACTGCGACAAGACGTTTGCA[C/T]GATCTGACGTGCTGAAGACCCACGAGAGGGTTCATACCGGAGAGAAACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link