zgc:194993

Ensembl ID:
ENSDARG00000052057
ZFIN ID:
ZDB-GENE-080722-44
Description:
procollagen C-endopeptidase enhancer-like [Source:RefSeq peptide;Acc:NP_001122259]
Human Orthologue:
PCOLCE
Human Description:
procollagen C-endopeptidase enhancer [Source:HGNC Symbol;Acc:8738]
Mouse Orthologue:
Pcolce
Mouse Description:
procollagen C-endopeptidase enhancer protein Gene [Source:MGI Symbol;Acc:MGI:105099]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21067 Nonsense Available for shipment Available now
sa1147 Nonsense Available for shipment Available now
sa21068 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073806 Nonsense 90 538 3 9
Genomic Location (Zv9):
Chromosome 7 (position 52313698)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50583448
GRCz11 7 50858518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTCCAGTTCAGGATCTTCGATCTAGAGGCAGATCCCACCTGCCGCTA[T/A]GACTATGTGGATGTCTATAATGGACACTCATACACAGTGCAGAAACTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073806 Nonsense 114 538 3 9
Genomic Location (Zv9):
Chromosome 7 (position 52313768)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50583518
GRCz11 7 50858588
KASP Assay ID:
554-1058.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGACACTCATACACAGTGCAGAAACTGGGYCGCTTCTGTGGKACATTC[A/T]GACCCGGAGCCCTGATCTCCACCTCTAACACCATGATGCTGGAGATGGCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073806 Nonsense 387 538 6 9
Genomic Location (Zv9):
Chromosome 7 (position 52319677)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50589427
GRCz11 7 50864497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAACCCGCCATTAGACCTCAACCAAAACCAACAAGTACAACAGCAAAG[C/T]AAGAAGTAAAGCCTGGAGTCAAACCAACAGCAAAGACCATCTCAAAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link