cmtm4

Ensembl ID:
ENSDARG00000052020
ZFIN ID:
ZDB-GENE-040718-195
Description:
CKLF-like MARVEL transmembrane domain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001002492]
Human Orthologue:
CMTM4
Human Description:
CKLF-like MARVEL transmembrane domain containing 4 [Source:HGNC Symbol;Acc:19175]
Mouse Orthologue:
Cmtm4
Mouse Description:
CKLF-like MARVEL transmembrane domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2142888]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44674 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073745 Nonsense 78 208 2 4
Genomic Location (Zv9):
Chromosome 7 (position 45641849)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44314677
GRCz11 7 44653902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTCTGGCTCTCATCTCGTTCATCTTCATTGAGACCATAATGATGTG[C/A]TCGCCGTGTGCCGGCGTCTACCTCTTTGAGTTTGTCAGCTGCAGTGCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link